Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
| Name | Class |
|---|---|
| Ministry of Education and Science, Republic of Kazakhstan | OTHER_GOV |
Not provided
Not provided
Not provided
Not provided
Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.
Today there are several methods for detecting BT:
The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.
For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.
The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.
The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).
During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.
This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).
Not provided
Not provided
Not provided
Not provided
Not provided
| Label | Type | Description | Intervention Names |
|---|---|---|---|
| Malignant ABO | 60 patients with malignant acute bowel obstruction |
| |
| CRC without ABO (control) | 60 colorectal cancer patients without acute bowel obstruction (planned operations) |
| |
| Benign ABO | 30 patients with benign acute bowel obstruction |
|
| Name | Type | Description | Arm Group Labels | Other Names |
|---|---|---|---|---|
| LBP | Diagnostic Test | Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. |
|
| Measure | Description | Time Frame |
|---|---|---|
| Change in Number of Participants With Post-operative Infectious and Inflammatory Complications | Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.) | Once (if any complication occurs during hospitalization - from 7 to 28 days) |
| Measure | Description | Time Frame |
|---|---|---|
| LBP Level in Serum Blood | LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic. | 1 hour before surgery, 72 hours after surgery |
| sCD14-ST Level in Serum Blood |
Not provided
Inclusion Criteria:
Exclusion Criteria:
Not provided
Not provided
Not provided
Patients with malignant and benign acute bowel obstruction, colorectal cancer patients without acute bowel obstruction (planned operations) aged from 18, who are expected to undergo surgical treatment for this pathology.
Not provided
| Name | Affiliation | Role |
|---|---|---|
| Yemek Turgunov, Pr. | NJSC Karaganda Medical University | Study Chair |
| Alina Ogizbayeva, PhD student | NJSC Karaganda Medical University | Principal Investigator |
| Lyudmila Akhmaltdinova, PhD | NJSC Karaganda Medical University | Principal Investigator |
| Kairat Shakeyev, Pr. | NJSC Karaganda Medical University | Principal Investigator |
| Dmitry Matyushko, PhD | Multidisciplinary hospital No. 1 of Karaganda | Principal Investigator |
| Miras Mugazov, PhD | NJSC Karaganda Medical University | Principal Investigator |
| Asylbek Zhumakaev, Master | Multidisciplinary hospital No. 3 of Karaganda | Principal Investigator |
| Irina Kadyrova, PhD | NJSC Karaganda Medical University | Principal Investigator |
| Facility | Status | City | State | ZIP | Country | Contacts |
|---|---|---|---|---|---|---|
| NJSC Karaganda Medical University | Karaganda | 100000 | Kazakhstan |
| PubMed Identifier | Type | Citation | Retractions |
|---|---|---|---|
| 26526435 | Background | Gore RM, Silvers RI, Thakrar KH, Wenzke DR, Mehta UK, Newmark GM, Berlin JW. Bowel Obstruction. Radiol Clin North Am. 2015 Nov;53(6):1225-40. doi: 10.1016/j.rcl.2015.06.008. | |
| 23758299 | Background | Taylor MR, Lalani N. Adult small bowel obstruction. Acad Emerg Med. 2013 Jun;20(6):528-44. doi: 10.1111/acem.12150. |
| Label | URL |
|---|---|
| Mierzchala M, Krzystek-Korpacka M, Gamian A, Durek G. Quantitative indices of dynamics in concentrations of lipopolysaccharide-binding protein (LBP) as prognostic factors in severe sepsis/septic shock patients - Comparison with CRP and procalcitonin / | View source |
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
| ID | Title | Description |
|---|---|---|
| FG000 | CRC Without ABO (Control) | 60 colorectal cancer patients without acute bowel obstruction (planned operations) Lipopolysaccharide-binding protein (LBP): Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. soluble CD14 subtype (sCD14-ST): Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. 16 subunits of ribosomal ribonucleic acid (16s rRNA): Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. |
| Title | Milestones | Reasons Not Completed | |||||
|---|---|---|---|---|---|---|---|
| Overall Study |
|
Not provided
Not provided
| Type | Includes Protocol | Includes SAP | Includes ICF | Document Label | Document Date | Document Uploaded Date | Document File Name |
|---|---|---|---|---|---|---|---|
| Prot_SAP | Yes | Yes | No | Study Protocol and Statistical Analysis Plan | Jan 14, 2022 |
Not provided
Not provided
Not provided
Not provided
| sCD14-ST | Diagnostic Test | Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. |
|
| 16s rRNA | Diagnostic Test | Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. |
|
sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
| 1 hour before surgery, 72 hours after surgery |
| 16s rRNA in Mesenteric Lymph Nodes | Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups. | Once (MLN sampling in sterile conditions during surgery) |
| 30213414 | Background | Roses RE, Folkert IW, Krouse RS. Malignant Bowel Obstruction: Reappraising the Value of Surgery. Surg Oncol Clin N Am. 2018 Oct;27(4):705-715. doi: 10.1016/j.soc.2018.05.010. Epub 2018 Jul 21. |
| 27742029 | Background | Shwaartz C, Fields AC, Prigoff JG, Aalberg JJ, Divino CM. Should patients With obstructing colorectal cancer have proximal diversion? Am J Surg. 2017 Apr;213(4):742-747. doi: 10.1016/j.amjsurg.2016.08.005. Epub 2016 Sep 2. |
| 28173723 | Background | Chiu HC, Lin YC, Hsieh HM, Chen HP, Wang HL, Wang JY. The impact of complications on prolonged length of hospital stay after resection in colorectal cancer: A retrospective study of Taiwanese patients. J Int Med Res. 2017 Apr;45(2):691-705. doi: 10.1177/0300060516684087. Epub 2017 Feb 7. |
| 30903246 | Background | Simillis C, Kalakouti E, Afxentiou T, Kontovounisios C, Smith JJ, Cunningham D, Adamina M, Tekkis PP. Primary Tumor Resection in Patients with Incurable Localized or Metastatic Colorectal Cancer: A Systematic Review and Meta-analysis. World J Surg. 2019 Jul;43(7):1829-1840. doi: 10.1007/s00268-019-04984-2. |
| 27783343 | Background | Wancata LM, Abdelsattar ZM, Suwanabol PA, Campbell DA Jr, Hendren S. Outcomes After Surgery for Benign and Malignant Small Bowel Obstruction. J Gastrointest Surg. 2017 Feb;21(2):363-371. doi: 10.1007/s11605-016-3307-8. Epub 2016 Oct 25. |
| 25809624 | Background | Stubljar D, Skvarc M. Effective Strategies for Diagnosis of Systemic Inflammatory Response Syndrome (SIRS) due to Bacterial Infection in Surgical Patients. Infect Disord Drug Targets. 2015;15(1):53-6. doi: 10.2174/1871526515666150320161804. |
| 28260787 | Background | Levy M, Kolodziejczyk AA, Thaiss CA, Elinav E. Dysbiosis and the immune system. Nat Rev Immunol. 2017 Apr;17(4):219-232. doi: 10.1038/nri.2017.7. Epub 2017 Mar 6. |
| 26808138 | Background | Piton G, Capellier G. Biomarkers of gut barrier failure in the ICU. Curr Opin Crit Care. 2016 Apr;22(2):152-60. doi: 10.1097/MCC.0000000000000283. |
| 19252406 | Background | Tsujimoto H, Ono S, Mochizuki H. Role of translocation of pathogen-associated molecular patterns in sepsis. Dig Surg. 2009;26(2):100-9. doi: 10.1159/000206143. Epub 2009 Mar 2. |
| 16288452 | Background | MacFie J, Reddy BS, Gatt M, Jain PK, Sowdi R, Mitchell CJ. Bacterial translocation studied in 927 patients over 13 years. Br J Surg. 2006 Jan;93(1):87-93. doi: 10.1002/bjs.5184. |
| 25025695 | Background | Fang L, Xu Z, Wang GS, Ji FY, Mei CX, Liu J, Wu GM. Directed evolution of an LBP/CD14 inhibitory peptide and its anti-endotoxin activity. PLoS One. 2014 Jul 15;9(7):e101406. doi: 10.1371/journal.pone.0101406. eCollection 2014. |
| 22960476 | Background | Stehle JR Jr, Leng X, Kitzman DW, Nicklas BJ, Kritchevsky SB, High KP. Lipopolysaccharide-binding protein, a surrogate marker of microbial translocation, is associated with physical function in healthy older adults. J Gerontol A Biol Sci Med Sci. 2012 Nov;67(11):1212-8. doi: 10.1093/gerona/gls178. Epub 2012 Sep 7. |
| 26345428 | Background | Kell DB, Pretorius E. On the translocation of bacteria and their lipopolysaccharides between blood and peripheral locations in chronic, inflammatory diseases: the central roles of LPS and LPS-induced cell death. Integr Biol (Camb). 2015 Nov;7(11):1339-77. doi: 10.1039/c5ib00158g. |
| 21740312 | Background | Mussap M, Noto A, Fravega M, Fanos V. Soluble CD14 subtype presepsin (sCD14-ST) and lipopolysaccharide binding protein (LBP) in neonatal sepsis: new clinical and analytical perspectives for two old biomarkers. J Matern Fetal Neonatal Med. 2011 Oct;24 Suppl 2:12-4. doi: 10.3109/14767058.2011.601923. |
| 31159729 | Background | van Maldeghem I, Nusman CM, Visser DH. Soluble CD14 subtype (sCD14-ST) as biomarker in neonatal early-onset sepsis and late-onset sepsis: a systematic review and meta-analysis. BMC Immunol. 2019 Jun 3;20(1):17. doi: 10.1186/s12865-019-0298-8. |
| 28961693 | Background | Hosomi S, Yamagami H, Itani S, Yukawa T, Otani K, Nagami Y, Tanaka F, Taira K, Kamata N, Tanigawa T, Shiba M, Watanabe T, Fujiwara Y. Sepsis Markers Soluble IL-2 Receptor and Soluble CD14 Subtype as Potential Biomarkers for Complete Mucosal Healing in Patients With Inflammatory Bowel Disease. J Crohns Colitis. 2018 Jan 5;12(1):87-95. doi: 10.1093/ecco-jcc/jjx124. |
| 24462421 | Background | Endo S, Suzuki Y, Takahashi G, Shozushima T, Ishikura H, Murai A, Nishida T, Irie Y, Miura M, Iguchi H, Fukui Y, Tanaka K, Nojima T, Okamura Y. Presepsin as a powerful monitoring tool for the prognosis and treatment of sepsis: a multicenter prospective study. J Infect Chemother. 2014 Jan;20(1):30-4. doi: 10.1016/j.jiac.2013.07.005. Epub 2013 Dec 11. |
| Masson S, Caironi P, Fanizza C, Thomae R, Bernasconi R, Noto A, Oggioni R, Pasetti GS, Romero M, Tognoni G, Latini R, Gattinoni L. Circulating presepsin (soluble CD14 subtype) as a marker of host response in patients with severe sepsis or septic shock | View source |
| FG001 | Malignant ABO | 60 patients with malignant acute bowel obstruction Lipopolysaccharide-binding protein (LBP): Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. soluble CD14 subtype (sCD14-ST): Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. 16 subunits of ribosomal ribonucleic acid (16s rRNA): Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. |
| FG002 | Benign ABO | 30 patients with benign acute bowel obstruction Lipopolysaccharide-binding protein (LBP): Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. soluble CD14 subtype (sCD14-ST): Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. 16 subunits of ribosomal ribonucleic acid (16s rRNA): Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. |
| COMPLETED |
|
| NOT COMPLETED |
|
The acceptance criteria are as follows: patients undergoing planned surgical intervention for colorectal tumor, patients with ABO of tumor and non-tumor genesis over 18 years of age.
The exclusion criteria included: age under 18 years, pregnant women, patients with paralytic/dynamic ABO, patients with HIV infection, liver cirrhosis as well as those patients with an ongoing infectious process due to another pathology.
Not provided
| ID | Title | Description |
|---|---|---|
| BG000 | Malignant ABO | 60 patients with malignant acute bowel obstruction LBP: Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. sCD14-ST: Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. 16s rRNA: Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. TNM international classification of malignant neoplasm stages was used with grouping by stages I-IV according to the latest 8th revision of the classification. |
| BG001 | CRC Without ABO (Control) | 60 colorectal cancer patients without acute bowel obstruction (planned operations) LBP: Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. sCD14-ST: Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. 16s rRNA: Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. TNM international classification of malignant neoplasm stages was used with grouping by stages I-IV according to the latest 8th revision of the classification. |
| BG002 | Benign ABO | 30 patients with benign acute bowel obstruction LBP: Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. sCD14-ST: Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. 16s rRNA: Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. |
| BG003 | Total | Total of all reporting groups |
| Units | Counts |
|---|---|
| Participants |
|
| Title | Description | Population Description | Parameter Type | Dispersion Type | Unit of Measure | Calculate Percentage | Denominator Units Selected | Denominators | Classes | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Age, Categorical | Age was measured in complete years. | Count of Participants | Participants |
| ||||||||||
| Age, Continuous | For each group, the median age in years was calculated. | Median | Inter-Quartile Range | years |
| |||||||||
| Sex: Female, Male | Count of Participants | Participants |
| |||||||||||
| Race and Ethnicity Not Collected | Race and Ethnicity were not collected from any participant. | Count of Participants | Participants |
| ||||||||||
| Region of Enrollment | Region of Enrollment - four hospitals in the city of Karaganda, Kazakhstan: Regional Clinical Hospital, Professor H.J. Maqajanov Multidisciplinary Hospital, Multidisciplinary Hospital No. 1 of Karaganda city, Multidisciplinary Hospital No. 3 of Karaganda city | Number | participants |
| ||||||||||
| Stage of the tumor process | Colon cancer is staged using the American Joint Committee on Cancer (AJCC) tumor/node/metastasis (TNM) classification and staging system (8th revision of the classification). In this system, I-IV stages are assigned on the basis of the characteristics of the primary tumor (T) and the extent of regional lymph node involvement (N) and distant metastasis (M). Stage IV was considered worse outcomes. | The stage of the tumor process (I-IV) is not applicable to the group "Benign ABO" | Count of Participants | Participants |
|
| Type | Title | Description | Population Description | Reporting Status | Anticipated Posting Date | Parameter Type | Dispersion Type | Unit of Measure | Calculate Percentage | Time Frame | Units Analyzed | Denominator Units Selected | Arm/Group Information | Denominators | Classes | Analyses | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Primary | Change in Number of Participants With Post-operative Infectious and Inflammatory Complications | Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.) | Posted | Count of Participants | Participants | Once (if any complication occurs during hospitalization - from 7 to 28 days) |
|
|
| |||||||||||||||||||||||||||||||||||
| Secondary | LBP Level in Serum Blood | LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic. | Posted | Median | Inter-Quartile Range | ng/mL | 1 hour before surgery, 72 hours after surgery |
| ||||||||||||||||||||||||||||||||||||
| Secondary | sCD14-ST Level in Serum Blood | sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic. | Posted | Median | Inter-Quartile Range | pg/mL | 1 hour before surgery, 72 hours after surgery |
| ||||||||||||||||||||||||||||||||||||
| Secondary | 16s rRNA in Mesenteric Lymph Nodes | Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups. | Posted | Number | Count of Participants | Once (MLN sampling in sterile conditions during surgery) |
|
During hospitalization (from 7 to 28 days)
Not applicable. Because the study is observational, without any intervention
Not provided
| ID | Title | Description | Deaths (Affected) | Deaths (At Risk) | Serious Events (Affected) | Serious Events (At Risk) | Other Events (Affected) | Other Events (At Risk) |
|---|---|---|---|---|---|---|---|---|
| EG000 | Malignant ABO | 60 patients with malignant acute bowel obstruction LBP: Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. sCD14-ST: Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. 16s rRNA: Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. | 12 | 60 | 0 | 60 | 0 | 60 |
| EG001 | CRC Without ABO (Control) | 60 colorectal cancer patients without acute bowel obstruction (planned operations) LBP: Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. sCD14-ST: Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. 16s rRNA: Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. | 1 | 60 | 0 | 60 | 0 | 60 |
| EG002 | Benign ABO | 30 patients with benign acute bowel obstruction LBP: Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. sCD14-ST: Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it. 16s rRNA: Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method. | 2 | 30 | 0 | 30 | 0 | 30 |
Not provided
Not provided
Not provided
Not provided
Not provided
| Title | Organization | Phone | Extension | |
|---|---|---|---|---|
| Dr. Yermek Turguov | NJSC KARAGANDA MEDICAL UNIVERSITY | +77016119655 | Turgunov@qmu.kz |
| Jan 2, 2024 |
| Prot_SAP_001.pdf |
| ID | Term |
|---|---|
| D007415 | Intestinal Obstruction |
| D015179 | Colorectal Neoplasms |
| D011183 | Postoperative Complications |
| D018746 | Systemic Inflammatory Response Syndrome |
| D003110 | Colonic Neoplasms |
| ID | Term |
|---|---|
| D007410 | Intestinal Diseases |
| D005767 | Gastrointestinal Diseases |
| D004066 | Digestive System Diseases |
| D007414 | Intestinal Neoplasms |
| D005770 | Gastrointestinal Neoplasms |
| D004067 | Digestive System Neoplasms |
| D009371 | Neoplasms by Site |
| D009369 | Neoplasms |
| D003108 | Colonic Diseases |
| D012002 | Rectal Diseases |
| D010335 | Pathologic Processes |
| D013568 | Pathological Conditions, Signs and Symptoms |
| D007249 | Inflammation |
| D012769 | Shock |
Not provided
Not provided
|
|
|
|
|
|
|
|
|
|
|
|