Not provided
| ID | Type | Description | Link |
|---|---|---|---|
| TRANSLATE | Other Identifier | Alias Study Number | |
| 2018-003612-45 | EudraCT Number |
Not provided
Not provided
Not provided
Study terminated due to lack of enrollment that has been compounded by the global COVID-19 pandemic. There were no safety and/or efficacy concerns involved in the decision to stop enrollment.
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
The TRANSLATE study aims to better understand why tumors become resistant to standard anti-cancer therapies.
New tumor biopsy and blood samples are collected after disease progression on standard-of-care anti-cancer treatment and compared to the initial (archival) tumor biopsy sample taken from the same patient.
Annotated reports of results from clinical Next Generation Sequencing (NGS) gene panel tests of both tumor and blood are sent directly from the testing lab to the study physician for discussion with the patient during the study.
Patients may participate in interventional treatment clinical trials at the same time as participating in the TRANSLATE study.
Primary data will be publicly available after the study to support further research.
Background: Development of new cancer treatments requires better understanding of why tumors develop resistance to standard-of-care (SOC) therapies. However, post-progression tumor biopsies are not routinely collected, limiting the tissue available to characterize mechanisms of treatment resistance. The TRANSLATE clinical study is specifically designed to address these critical gaps.
Trial design: TRANSLATE is a global, multicenter, translational study designed to collect and compare archival pre-treatment tumor tissue with paired de novo tumor and blood samples obtained following disease progression on SOC therapies, targeting therapeutically important areas of cancer biology.
Eligible Tumor Type and Most Recent SOC Therapy:
Eligibility criteria include adults with locally advanced or metastatic tumors; radiographic evidence of progressive disease during the most recent SOC regimen; sufficient archival tumor tissue; and a post-progression tumor lesion that is safely accessible for a new biopsy.
The results from clinical NGS panel testing may help inform subsequent treatment plan or identification of relevant interventional clinical trials.
Patients are enrolled after disease progression on SOC and before change in treatment and participate in 3 study visits within approximately 3 months.
Next-generation sequencing results from analysis of tumor tissue and blood will be returned to the study physician and patient for review at a subsequent study visit within this timeframe.
The primary endpoint is the change in frequency of gene alterations between pre-treatment and post-progression tumor biopsies. Secondary endpoints address prioritized scientific hypotheses specific to each target area of biology and indication.
Primary data will be publicly available after the study to support further research.
Sponsored by Pfizer Inc.; EudraCT: 2018-003612-45.
Not provided
Not provided
Not provided
Not provided
| Label | Type | Description | Intervention Names |
|---|---|---|---|
| Tumor biopsy and blood draw | Other | Tumor biopsy and blood draw |
|
| Name | Type | Description | Arm Group Labels | Other Names |
|---|---|---|---|---|
| De novo tumor tissue biopsy | Procedure | De novo tissue biopsy performed following disease progression |
|
| Measure | Description | Time Frame |
|---|---|---|
| Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | Change in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS. | Through study completion, approximately 3 months |
| Measure | Description | Time Frame |
|---|---|---|
| Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Estimating the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that were adequate to meet the objectives of the study | Through study completion, approximately 3 months |
Not provided
Inclusion Criteria:
Exclusion Criteria:
Not provided
Not provided
Not provided
Not provided
Not provided
Not provided
| Name | Affiliation | Role |
|---|---|---|
| Pfizer CT.gov Call Center | Pfizer | Study Director |
| Facility | Status | City | State | ZIP | Country | Contacts |
|---|---|---|---|---|---|---|
| Southern Cancer Center, P.C. | Daphne | Alabama | 36526 | United States | ||
| Southern Cancer Center, PC |
Not provided
| Label | URL |
|---|---|
| To obtain contact information for a study center near you, click here. | View source |
Not provided
Pfizer will provide access to individual de-identified participant data and related study documents (e.g. protocol, Statistical Analysis Plan (SAP), Clinical Study Report (CSR)) upon request from qualified researchers, and subject to certain criteria, conditions, and exceptions. Further details on Pfizer's data sharing criteria and process for requesting access can be found at: https://www.pfizer.com/science/clinical\_trials/trial\_data\_and\_results/data\_requests.
Not provided
Not provided
Not provided
Not provided
A total of 38 participants were enrolled into 7 cohorts. The Safety Analysis (SA) population included 36 participants who had de novo biopsy or research blood draw performed.
Not provided
Not provided
| ID | Title | Description |
|---|---|---|
| FG000 | Cohort 1: Non-small Cell Lung Carcinoma (NSCLC) Monotherapy | Progressive disease on 1st line monotherapy anti-programmed cell death receptor 1 or programmed cell death ligand 1 (anti-PD-1/-L1). |
| FG001 | Cohort 2: NSCLC Combination |
| Title | Milestones | Reasons Not Completed | |||||
|---|---|---|---|---|---|---|---|
| Overall Study |
|
Not provided
Not provided
| Type | Includes Protocol | Includes SAP | Includes ICF | Document Label | Document Date | Document Uploaded Date | Document File Name |
|---|---|---|---|---|---|---|---|
| Prot | Yes | No | No | Study Protocol | May 12, 2020 | Nov 29, 2021 |
Not provided
Not provided
Not provided
Not provided
Not provided
| Research blood draws | Procedure | Blood biospecimens collected following disease progression |
|
| Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results | Genetic alterations detected in blood were compared to those detected in tissue. Only gene alterations with frequency of 5% or greater based on assessment of tumor biopsy were included in the analysis. | Through study completion, approximately 3 months |
| Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Calculation of change in frequency was decribed in the primary endpoint (Outcome Measure 1). | Through study completion, approximately 3 months |
| Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA | Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Percentage of Participants Who Carried the RB1 Gene Alterations in Post Progression Blood cfDNA analysis was only conducted for Cohort 4 as per protocol. | Through study completion, approximately 3 months |
| Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | Pre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies. Calculation of change in frequency was described for in the primary endpoint (Outcome Measure 1). AR gene Alterations analysis was only conducted for the Cohorts 5 & 6 as per protocol. | Through study completion, approximately 3 months |
| Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA | Androgen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone. Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA analysis was conducted as it was only applicable to Cohorts 5 &6. | Through study completion, approximately 3 months |
| Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | The differences in the expression of nuclear hormone receptor (HR) reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET [targeted tumor RNA (TTR)] population and Tempus RNAseq in BET [whole transcriptome tumor RNA (WTTR)] population. The unit of HTG expression data for nuclear hormone receptors is normalized expression counts. This Outcome Measure analysis was only conducted for Cohorts 5 & 6 as per protocol. | Through study completion, approximately 3 months |
| Mobile |
| Alabama |
| 36607 |
| United States |
| Southern Cancer Center, PC | Mobile | Alabama | 36608 | United States |
| Alaska Urological Institute dba Alaska Clinical Research Center | Anchorage | Alaska | 99503 | United States |
| Arizona Oncology Associates, PC-HOPE | Tucson | Arizona | 85704 | United States |
| Arizona Oncology Associates, PC - HOPE | Tucson | Arizona | 85711 | United States |
| The Oncology Institute of Hope Innovation | Glendale | California | 91204 | United States |
| The Oncology Institute of Hope Innovation | Long Beach | California | 90805 | United States |
| UCI Medical Center-Chao Family Comprehensive Cancer Center | Orange | California | 92868-3201 | United States |
| The Oncology Institute of Hope Innovation | Santa Ana | California | 92705 | United States |
| Sansum Clinic | Santa Barbara | California | 93105 | United States |
| Sansum Clinic | Solvang | California | 93463 | United States |
| The Oncology Institute of Hope and Innovation | Whittier | California | 90602 | United States |
| ICRI-Administrative and Supplies Only | Whittier | California | 90603 | United States |
| Woodlands Medical Specialists PA | Pensacola | Florida | 32503 | United States |
| Seattle Cancer Care Alliance | Seattle | Washington | 98109 | United States |
| University of Washington Medical Center | Seattle | Washington | 98195 | United States |
| ClÃnica Viedma S.A. | Viedma | RÃo Negro Province | 8500 | Argentina |
| Sanatorio de la Mujer | Rosario | Santa Fe Province | S2000ORE | Argentina |
| Hospital Britanico de Buenos Aires | CABA | C1280AEB | Argentina |
| Centro de Educacion Medica e Investigaciones Clinicas"Norberto Quirno" CEMIC | Ciudad Autónoma de Bs As | C1431FWO | Argentina |
| Grand Hôpital de Charleroi - Site Notre Dame | Charleroi | 6000 | Belgium |
| AZ Maria Middelares | Ghent | 9000 | Belgium |
| UZ Gent | Ghent | 9000 | Belgium |
| Hôpital de Jolimont | Haine-Saint-Paul | 7100 | Belgium |
| Clinique Saint-Pierre Ottignies | Ottignies | 1340 | Belgium |
| Centre Jean Perrin | Clermont-Ferrand | 63011 | France |
| Hôpitaux Civils de Colmar, Centre Hospitalier Louis Pasteur | Colmar | 68024 | France |
| CHU Henri Mondor | Créteil | 94010 | France |
| Hôpital La Croix du Sud | Quint-Fonsegrives | 31130 | France |
| Institut Jean Godinot | Reims | 51056 | France |
| Hopital Bégin | Saint-Mandé | 94160 | France |
| Royal Cornwall Hospital | Cornwall | TR1 3IJ | United Kingdom |
Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1.
| FG002 | Cohort 3: Renal Cell Carcinoma (RCC) With Clear Cell Component | Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib. |
| FG003 | Cohort 4: Hormone Receptor+Human Epidermal Growth Factor Receptor 2 - Adenocarcinoma of the Breast | Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy. |
| FG004 | Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate | Progressive disease on enzalutamide monotherapy. |
| FG005 | Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate | Progressive disease on abiraterone in combination with prednisone. |
| FG006 | Cohort 7: Germline Mutated BRCA (gBRCAm) HER2- Adenocarcinoma of the Breast | Progressive disease on a poly ADP-ribose polymerase (PARP) inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting. |
| COMPLETED |
|
| NOT COMPLETED |
|
|
Not provided
| ID | Title | Description |
|---|---|---|
| BG000 | Cohort 1: NSCLC Monotherapy | Progressive disease on 1st line monotherapy anti-PD-1/-L1. |
| BG001 | Cohort 2: NSCLC Combination | Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1. |
| BG002 | Cohort 3: RCC With Clear Cell Component | Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib. |
| BG003 | Cohort 4: HR+ HER2- Adenocarcinoma of the Breast | Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy. |
| BG004 | Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate | Progressive disease on enzalutamide monotherapy. |
| BG005 | Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate | Progressive disease on abiraterone in combination with prednisone. |
| BG006 | Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast | Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting. |
| BG007 | Total | Total of all reporting groups |
| Units | Counts |
|---|---|
| Participants |
|
| Title | Description | Population Description | Parameter Type | Dispersion Type | Unit of Measure | Calculate Percentage | Denominator Units Selected | Denominators | Classes | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Age, Continuous | Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population | Mean | Standard Deviation | Years |
| ||||||||||||||
| Sex: Female, Male | Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population | Count of Participants | Participants |
| |||||||||||||||
| Ethnicity (NIH/OMB) | Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population | Count of Participants | Participants |
| |||||||||||||||
| Race/Ethnicity, Customized | Data collected for Demographics and Baseline Characteristics Summary only in Safety Analysis Population | Count of Participants | Participants |
|
| Type | Title | Description | Population Description | Reporting Status | Anticipated Posting Date | Parameter Type | Dispersion Type | Unit of Measure | Calculate Percentage | Time Frame | Units Analyzed | Denominator Units Selected | Arm/Group Information | Denominators | Classes | Analyses | ||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Primary | Change in the Frequency of Gene Alterations Between Pre-treatment Tumor Samples (Archival) and Post-progression (De Novo) Tumor Biopsies | Change in frequency is calculated by (frequency in de novo samples) - (frequency in archival samples). The frequency of each gene alteration is calculated as number of patients who harbored the alteration divided by the total number of patients in the cohort. Only gene alterations with variant allele frequency of 5% or greater were included in the analysis. Two different sequencing techniques were applied so 2 analysis sets were repeated for each cohort: targeted panel next-generation sequencing (NGS) and whole exome sequencing NGS. | Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol. | Posted | Number | 95% Confidence Interval | Percentage of Participants | Through study completion, approximately 3 months |
|
|
| |||||||||||||||||||||||||||||
| Secondary | Number of Participants With Fully Evaluable Archival and Post-Progression Tumor Biopsy by Cohort | Estimating the number of fully biomarker evaluable population by cohort to evaluate the success rate in obtaining paired archival and post-progression tumor biopsies that were adequate to meet the objectives of the study | Participants included in the Safety Analysis population in 7 cohorts. | Posted | Count of Participants | Participants | Through study completion, approximately 3 months |
| ||||||||||||||||||||||||||||||||
| Secondary | Overall Agreement Rate of Gene Alterations Between Post-Progression Tumor Biopsy and Blood NGS Results | Genetic alterations detected in blood were compared to those detected in tissue. Only gene alterations with frequency of 5% or greater based on assessment of tumor biopsy were included in the analysis. | Number of Participants Analyzed shows the number of participants with available results for the corresponding gene alterations. Data for this outcome measure was not collected for Cohorts 1,2, 3 and 7 due to early termination of the study by Sponsor. Data for Cohorts 5 and 6 was combined to report combined results for Cohorts 5 and 6, to meet the sample size was deemed sufficient to generate informative summary statistics, as pre-specified in the Study Protocol. | Posted | Median | Full Range | Percentage of agreed gene alterations | Through study completion, approximately 3 months |
| |||||||||||||||||||||||||||||||
| Secondary | Change in Frequency of RB1 Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Calculation of change in frequency was decribed in the primary endpoint (Outcome Measure 1). | The BET population was participants in the BE population who had a targeted tumor DNA panel biomarker result from both archival and de novo biopsy tumor tissue biospecimen. BET (WETD) was defined as all participants in the BET population who had results of WETD NGS sample analysis from both the archival and de novo biopsy tumor tissue biospecimen. RB1 Gene Alterations analysis was only conducted for Cohort 4 as per protocol. | Posted | Number | 95% Confidence Interval | Percentage of participants | Through study completion, approximately 3 months |
| |||||||||||||||||||||||||||||||
| Secondary | Percentage of Participants Who Carried the RB1 Gene Alterations in Post-Progression Blood cfDNA | Mutations in RB1 gene associated with immune function, have also been shown to impact tumor immunogenicity and related with CDK4/6 inhibition. CDK4 or CDK6 complexed with cyclin D1 (CCND1) phosphorylates the retinoblastoma gene product (Rb), releasing the E2F and DP transcription factors that regulate the expression of genes required for entry into the S phase of the cell cycle. Percentage of Participants Who Carried the RB1 Gene Alterations in Post Progression Blood cfDNA analysis was only conducted for Cohort 4 as per protocol. | BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample. | Posted | Number | 95% Confidence Interval | Percentage of participants | Through study completion, approximately 3 months |
|
| ||||||||||||||||||||||||||||||
| Secondary | Change in Frequency of AR Gene Alterations Between Pre-Treatment Archival and Post-Progression Samples | Pre-treatment archival tumor samples and post-progression de novo tumor biopsies were analyzed to identify molecular markers of resistance to selected anti-cancer therapies. Calculation of change in frequency was described for in the primary endpoint (Outcome Measure 1). AR gene Alterations analysis was only conducted for the Cohorts 5 & 6 as per protocol. | The BET and BET (WETD) population was participants in the BE population who have a targeted tumor DNA panel biomarker result, and all participants in the BET population who have results of WETD NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements. | Posted | Number | 95% Confidence Interval | percentage of participants | Through study completion, approximately 3 months |
| |||||||||||||||||||||||||||||||
| Secondary | Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA | Androgen receptor (AR) gene alterations can be evaluated as mechanisms of resistance to enzalutamide or abiraterone. Percentage of Participants Who Carried the AR Gene Alterations in Post-Progression Blood cfDNA analysis was conducted as it was only applicable to Cohorts 5 &6. | BE (TBD) was analyzed and defined as all participants in the BE population who have results of targeted blood cfDNA (TBD) NGS gene panel sample analysis from the post-progression blood sample. | Posted | Number | 95% Confidence Interval | Percentage of participants | Through study completion, approximately 3 months |
|
| ||||||||||||||||||||||||||||||
| Secondary | Change in Expression of Nuclear Hormone Receptors Between Pre-Treatment Archival and Post-Progression Samples | The differences in the expression of nuclear hormone receptor (HR) reflecting nuclear receptor pathway activity between the archival and de novo samples. Using HTG panel in BET [targeted tumor RNA (TTR)] population and Tempus RNAseq in BET [whole transcriptome tumor RNA (WTTR)] population. The unit of HTG expression data for nuclear hormone receptors is normalized expression counts. This Outcome Measure analysis was only conducted for Cohorts 5 & 6 as per protocol. | BET (TTR) and BET (WTTR) population was all participants in the BET population who have results of TTR sample analysis, and all participants in the BET population who have results of WTTR NGS sample analysis, from both the archival and de novo biopsy tumor tissue biospecimen, respectively. One participant in Cohort 6 was included in the BET analysis population given the small number of eligible samples and the fact that participant's bone sample met analytical requirements. | Posted | Mean | 95% Confidence Interval | normalized expression counts | Through study completion, approximately 3 months |
|
From Biospecimen Collection Day 1 to Post-Biospecimen Follow-up ≤30 days after receipt of NGS results at the provider's facility, approximately 3 months through study completion.
Not provided
Not provided
| ID | Title | Description | Deaths (Affected) | Deaths (At Risk) | Serious Events (Affected) | Serious Events (At Risk) | Other Events (Affected) | Other Events (At Risk) |
|---|---|---|---|---|---|---|---|---|
| EG000 | Cohort 1: NSCLC Monotherapy | Progressive disease on 1st line monotherapy anti-PD-1/-L1. | 0 | 1 | 0 | 1 | 0 | 1 |
| EG001 | Cohort 2: NSCLC Combination | Progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen; or progressive disease on 1st line anti-PD-1/-L1 plus standard doublet platinum-containing regimen followed by continuation of single agent anti-PD-1/-L1. | 0 | 4 | 0 | 4 | 0 | 4 |
| EG002 | Cohort 3: RCC With Clear Cell Component | Progressive disease on 2nd line monotherapy anti-PD-1/-L1; or progressive disease on 1st line combination of doublet anti-PD-1/-L1 with anti-CTLA-4; or progressive disease on 1st line combination of avelumab with axitinib or pembrolizumab with axitinib. | 0 | 5 | 0 | 5 | 0 | 5 |
| EG003 | Cohort 4: HR+ HER2- Adenocarcinoma of the Breast | Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy. | 0 | 10 | 0 | 10 | 1 | 10 |
| EG004 | Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate | Progressive disease on enzalutamide monotherapy. | 0 | 5 | 0 | 5 | 1 | 5 |
| EG005 | Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate | Progressive disease on abiraterone in combination with prednisone. | 0 | 10 | 0 | 10 | 0 | 10 |
| EG006 | Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast | Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting. | 0 | 1 | 0 | 1 | 0 | 1 |
Not provided
| Term | Organ System | Source Vocabulary | Assessment Type | Notes | Statistical Information |
|---|---|---|---|---|---|
| Post procedural contusion | Injury, poisoning and procedural complications | MedDRA version 23.1 | Non-systematic Assessment |
| |
| Syncope | Nervous system disorders | MedDRA version 23.1 | Non-systematic Assessment |
| |
| Dermatitis contact | Skin and subcutaneous tissue disorders | MedDRA version 23.1 | Non-systematic Assessment |
| |
| Procedural pain | Injury, poisoning and procedural complications | MedDRA version 23.1 | Non-systematic Assessment |
|
Because of given challenges with study enrollment that were compounded by the global COVID-19 pandemic, and the observed high failure rate of tumor biospecimen analyses due to limitations in sample quality and quantity, the study was terminated in October 2020, which was not due to safety concerns or regulatory interactions. For endpoints with no data collected, no results can be disclosed.
Pfizer has the right to review disclosures, requesting a delay of less than 60 days. Investigator will postpone single center publications until after disclosure of pooled data (all sites), less than 12 months from study completion/termination at all participating sites. Investigator may not disclose previously undisclosed confidential information other than study results.
| Title | Organization | Phone | Extension | |
|---|---|---|---|---|
| Pfizer ClinicalTrials.gov Call Center | Pfizer, Inc. | 1-800-718-1021 | ClinicalTrials.gov_Inquiries@pfizer.com |
| Prot_000.pdf |
| SAP | No | Yes | No | Statistical Analysis Plan | Jun 2, 2020 | Nov 29, 2021 | SAP_001.pdf |
| ID | Term |
|---|---|
| D018450 | Disease Progression |
| D002289 | Carcinoma, Non-Small-Cell Lung |
| D002292 | Carcinoma, Renal Cell |
| ID | Term |
|---|---|
| D020969 | Disease Attributes |
| D010335 | Pathologic Processes |
| D013568 | Pathological Conditions, Signs and Symptoms |
| D002283 | Carcinoma, Bronchogenic |
| D001984 | Bronchial Neoplasms |
| D008175 | Lung Neoplasms |
| D012142 | Respiratory Tract Neoplasms |
| D013899 | Thoracic Neoplasms |
| D009371 | Neoplasms by Site |
| D009369 | Neoplasms |
| D008171 | Lung Diseases |
| D012140 | Respiratory Tract Diseases |
| D000230 | Adenocarcinoma |
| D002277 | Carcinoma |
| D009375 | Neoplasms, Glandular and Epithelial |
| D009370 | Neoplasms by Histologic Type |
| D007680 | Kidney Neoplasms |
| D014571 | Urologic Neoplasms |
| D014565 | Urogenital Neoplasms |
| D052776 | Female Urogenital Diseases |
| D005261 | Female Urogenital Diseases and Pregnancy Complications |
| D000091642 | Urogenital Diseases |
| D007674 | Kidney Diseases |
| D014570 | Urologic Diseases |
| D052801 | Male Urogenital Diseases |
Not provided
Not provided
| Male |
|
| Not Hispanic or Latino |
|
| Unknown or Not Reported |
|
| Multiracial |
|
| Not reported |
|
|
| ARHGAP39 c.2000G>A |
|
|
| ARHGAP39 c.2085G>C |
|
|
| ARID1A c.3145_3146dupCT |
|
|
| ARID1A c.3977dupC |
|
|
| ARID2 c.1803dupG |
|
|
| ASXL1 c.1934dupG |
|
|
| ATM c.5557G>A |
|
|
| ATM c.5948A>G |
|
|
| AXIN1 c.1881G>T |
|
|
| BAP1 c.179G>A |
|
|
| BCLAF1 c.615_619delATCAGinsGTCAT |
|
|
| BCOR c.476C>A |
|
|
| BRCA1 c.2612C>T |
|
|
| BRCA1 c.3113A>G |
|
|
| BRCA1 c.3548A>G |
|
|
| BRCA1 c.4837A>G |
|
|
| BRCA1 c.4956G>A |
|
|
| BRCA2 c.1114A>C |
|
|
| BRCA2 c.2803G>A |
|
|
| BRCA2 c.7397T>C |
|
|
| BRCA2 c.9976A>T |
|
|
| BRIP1 c.14G>C |
|
|
| BRIP1 c.2755T>C |
|
|
| CBR3 c.730G>A |
|
|
| CCNE1 c.1117G>A |
|
|
| CD22 c.757G>T |
|
|
| CD3EAP c.1516C>A |
|
|
| CDH1 c.1269delT |
|
|
| CDH1 c.466T>A |
|
|
| CREBBP c.1792C>T |
|
|
| CSF3R c.14G>T |
|
|
| DNM2 c.1782-5delC |
|
|
| DPYD c.1471G>T |
|
|
| DYNC2H1 c.1714A>G |
|
|
| ECH1 c.122A>C |
|
|
| ERBB2 c.1958C>G |
|
|
| ERBB2 c.2446C>T |
|
|
| ERCC5 c.440C>G |
|
|
| ESR1 c.1609T>A |
|
|
| ESR1 c.1610_1613delATGAinsGTGG |
|
|
| ESR1 c.1613A>G |
|
|
| FAM175A c.826_828delGAG |
|
|
| FANCA c.2426G>A |
|
|
| FANCD2 c.1214A>G |
|
|
| FANCE c.17C>G |
|
|
| FAT1 c.3818A>G |
|
|
| FGF9 c.375T>A |
|
|
| FGFR1 c.358+4G>A |
|
|
| FGFR1OP c.985-6_985-5dupTT |
|
|
| FLT4 c.1019G>C |
|
|
| FOXA1 c.247G>A |
|
|
| FOXA1 c.801G>T |
|
|
| FOXA1 c.874G>T |
|
|
| FOXQ1 c.1013A>G |
|
|
| FOXQ1 c.895G>A |
|
|
| FRS2 c.236G>T |
|
|
| GATA2 c.527C>T |
|
|
| GATA3 c.1223_1224insA |
|
|
| GNAS c.521G>A |
|
|
| GOT2 c.1037T>G |
|
|
| HEATR1 c.6347-4_6347-3dupTT |
|
|
| IRF2 c.744G>A |
|
|
| IRS2 c.3170G>A |
|
|
| ITPKB c.1222T>G |
|
|
| JAK1 c.1252G>C |
|
|
| JAK2 c.2743G>T |
|
|
| JAK3 c.757A>G |
|
|
| KDM6A c.2859-5delT |
|
|
| KDR c.2921G>T |
|
|
| KMT2C c.2536delG |
|
|
| KMT2C c.4270C>T |
|
|
| LMAN1 c.823-2dupA |
|
|
| LRP1B c.143A>G |
|
|
| LRP1B c.5737G>A |
|
|
| LTN1 c.1717A>G |
|
|
| LYN c.475G>T |
|
|
| MAP2K4 c.179C>A |
|
|
| MED12 c.1364G>T |
|
|
| MGMT c.520A>G |
|
|
| MGMT c.626A>G |
|
|
| MLH1 c.655A>G |
|
|
| MSH2 c.1748A>G |
|
|
| MSH6 c.116G>A |
|
|
| MSH6 c.3557-4dupT |
|
|
| MTHFR c.1286A>C |
|
|
| MUTYH c.1014G>C |
|
|
| MUTYH c.1187G>A |
|
|
| MYB c.1781C>G |
|
|
| NBN c.553G>C |
|
|
| NBN c.683T>G |
|
|
| NCOR1 c.4135G>T |
|
|
| NCOR2 c.1597G>A |
|
|
| NF1 c.7063-1G>T |
|
|
| NF1 c.849T>G |
|
|
| NOTCH1 c.2588-4G>A |
|
|
| NOTCH2 c.3522+3G>A |
|
|
| NOTCH3 c.539C>T |
|
|
| NTRK1 c.1806-4delA |
|
|
| NUP98 c.3310G>A |
|
|
| PALB2 c.1676A>G |
|
|
| PALB2 c.2014G>C |
|
|
| PIK3CA c.1035T>A |
|
|
| PIK3CA c.1633G>A |
|
|
| PIK3CA c.3140A>G |
|
|
| PIK3CG c.41A>G |
|
|
| PLCG2 c.2011A>G |
|
|
| PMS2 c.13G>C |
|
|
| PMS2 c.1408C>T |
|
|
| PMS2 c.1454C>A |
|
|
| PMS2 c.1621A>G |
|
|
| PMS2 c.2570G>C |
|
|
| PMS2 c.89A>G |
|
|
| POLD1 c.2959delG |
|
|
| PRKDC c.6424C>T |
|
|
| PTCH1 c.3746C>T |
|
|
| PTCH2 c.2134G>A |
|
|
| PTPN13 c.4097T>A |
|
|
| PTPN13 c.5683A>T |
|
|
| PTPN13 c.6256T>G |
|
|
| PUS3 c.1380G>C |
|
|
| RAD51C c.376G>A |
|
|
| RAD51D c.494G>A |
|
|
| RIT1 c.625G>C |
|
|
| RNF43 c.1252C>A |
|
|
| ROS1 c.1775_1777delGTG |
|
|
| RSF1 c.3025G>C |
|
|
| SF3B1 c.2077+4A>G |
|
|
| SOD2 c.47T>C |
|
|
| SYNE1 c.18758G>A |
|
|
| TBC1D12 c.1246C>T |
|
|
| TBC1D9B c.3356A>C |
|
|
| TBX3 c.364G>A |
|
|
| TBX3 c.820_827dupCCCGAAAC |
|
|
| TCF3 c.737C>T |
|
|
| TERT c.215G>A |
|
|
| TGFBR2 c.530-4T>A |
|
|
| TP53 c.215C>G |
|
|
| TP53 c.388delC |
|
|
| TP53 c.782+1G>A |
|
|
| TUSC3 c.99_101delGCT |
|
|
| ZFHX3 c.10931G>T |
|
|
| ZFHX3 c.1135C>G |
|
|
| ZFHX3 c.1631C>T |
|
|
| ZFHX3 c.2833T>G |
|
|
| ALK c.1043C>A |
|
|
| APLNR c.349G>A |
|
|
| CARD11 c.988G>A |
|
|
| CHD4 c.4060G>C |
|
|
| EGFR c.1008G>A |
|
|
| EP300 c.6613A>C |
|
|
| ERCC6 c.3661C>T |
|
|
| ERG c.1455_1461delCTACTAA |
|
|
| EZH2 c.848C>T |
|
|
| FBXO11 c.164_169delAGCAGC |
|
|
| FLT4 c.2405G>T |
|
|
| FOXO1 c.302C>T |
|
|
| GNAQ c.303C>A |
|
|
| HOTS c.233_236delTACTinsCACC |
|
|
| IRS2 c.1242C>A |
|
|
| KDM5C c.3019C>T |
|
|
| KIT c.597delA |
|
|
| KMT2A c.9400C>T |
|
|
| KMT2B c.26G>A |
|
|
| KMT2C c.4845G>A |
|
|
| LRP1B c.4439G>A |
|
|
| MAGEA10 c.1021G>T |
|
|
| MAP3K1 c.4292A>T |
|
|
| MET c.2318C>T |
|
|
| MSH6 c.1186C>G |
|
|
| MSH6 c.1486T>G |
|
|
| MUTYH c.64G>A |
|
|
| MYH11 c.5819dupC |
|
|
| NF1 c.1082G>C |
|
|
| NOTCH2 c.17_18delCC |
|
|
| NTRK3 c.137G>C |
|
|
| PALB2 c.2993G>A |
|
|
| PALLD c.270_275dupCCCGCC |
|
|
| PAX8 c.352G>A |
|
|
| PDGFRB c.1543G>C |
|
|
| PIK3R1 c.1690A>G |
|
|
| PIK3R1 c.935delC |
|
|
| PIK3R2 c.2047T>G |
|
|
| PLCG1 c.1825C>T |
|
|
| PLCG2 c.2114G>A |
|
|
| PMS2 c.1789A>T |
|
|
| PMS2 c.706-4delT |
|
|
| PTEN c.900delC |
|
|
| PTPRD c.2069A>G |
|
|
| RB1 c.1466G>A |
|
|
| RNF139 c.135C>G |
|
|
| ROS1 c.3416A>G |
|
|
| SPOP c.260A>G |
|
|
| SYNE1 c.25403G>A |
|
|
| TCF3 c.1643G>A |
|
|
| TEP1 c.3649C>T |
|
|
| TP53 c.993G>T |
|
|
| TP53 c.994-2A>G |
|
|
| U2AF1 c.101C>T |
|
|
| ZFHX3 c.11065A>G |
|
|
| AATK c.65C>T |
|
|
| ABCC9 c.4535C>T |
|
|
| ACADS c.989G>A |
|
|
| ACAP3 c.1990C>T |
|
|
| ACSL4 c.106G>A |
|
|
| ADAMTS13 c.3287G>A |
|
|
| ADAMTS7 c.227G>A |
|
|
| ADCY5 c.778C>T |
|
|
| ADGRE2 c.934C>A |
|
|
| ADGRE3 c.1411G>A |
|
|
| ADGRF2 c.680C>T |
|
|
| ADGRG3 c.1394C>T |
|
|
| ADH4 c.1174delA |
|
|
| AEBP1 c.799G>A |
|
|
| AGFG2 c.340C>A |
|
|
| AGPAT4 c.853C>T |
|
|
| AGRN c.184C>A |
|
|
| AGRN c.3157G>C |
|
|
| AHNAK2 c.13479G>A |
|
|
| AHNAK2 c.9650T>C |
|
|
| AKNA c.3907T>C |
|
|
| ALS2CL c.14A>G |
|
|
| ANKRD61 c.323C>G |
|
|
| ANKS1A c.157_159delGGC |
|
|
| ANKS1B c.2548C>A |
|
|
| ANTXR1 c.1121A>C |
|
|
| ANTXR2 c.940G>A |
|
|
| APC2 c.1312C>T |
|
|
| APLP1 c.1243C>T |
|
|
| ARF6 c.352_354delCTC |
|
|
| ARHGAP6 c.1585G>C |
|
|
| ARHGEF1 c.2031_2033delGCT |
|
|
| ARHGEF19 c.1379C>T |
|
|
| ARHGEF7 c.2072G>A |
|
|
| ARL10 c.53C>T |
|
|
| ARL6IP4 c.902_904delAGA |
|
|
| ARRDC4 c.227C>T |
|
|
| ARSI c.312G>A |
|
|
| ASCC3 c.5962A>G |
|
|
| ASH1L c.8522G>A |
|
|
| ASPRV1 c.985G>T |
|
|
| ATM c.3403-4dupT |
|
|
| ATP13A2 c.2984C>T |
|
|
| ATP2C2 c.2192delA |
|
|
| ATP6AP1 c.508A>C |
|
|
| ATP7A c.3388C>A |
|
|
| ATRN c.263_268delCGGCGG |
|
|
| B3GLCT c.517G>A |
|
|
| B4GALNT2 c.1414G>A |
|
|
| B4GALT7 c.431T>C |
|
|
| BEGAIN c.1231G>A |
|
|
| BEST1 c.273C>G |
|
|
| BET1 c.327dupT |
|
|
| BNC1 c.86G>A |
|
|
| BOC c.896G>A |
|
|
| BPIFB4 c.1146G>A |
|
|
| BRPF1 c.3069C>T |
|
|
| BRPF1 c.823G>C |
|
|
| BRWD3 c.3188G>T |
|
|
| BTBD17 c.106G>A |
|
|
| C10orf88 c.401dupA |
|
|
| C16orf47 c.329G>A |
|
|
| C16orf95 c.407G>A |
|
|
| C17orf100 c.71C>T |
|
|
| C17orf105 c.97G>A |
|
|
| C1QL4 c.185G>A |
|
|
| C1orf122 c.17G>A |
|
|
| C1orf168 c.2134G>A |
|
|
| C3 c.3566_3567delTG |
|
|
| C5orf60 c.770G>A |
|
|
| C7orf31 c.931A>G |
|
|
| CACNA1C c.169G>A |
|
|
| CACNA1D c.26_28delAAA |
|
|
| CACNA1D c.58C>A |
|
|
| CACNA1I c.2939G>A |
|
|
| CACNA1S c.4718C>T |
|
|
| CAD c.1429G>T |
|
|
| CADPS c.1595G>A |
|
|
| CAPS2 c.158C>T |
|
|
| CARS2 c.1419C>T |
|
|
| CATSPERE c.2471A>C |
|
|
| CC2D1A c.1030C>T |
|
|
| CC2D2B c.312G>A |
|
|
| CCDC105 c.895G>A |
|
|
| CCDC114 c.445G>A |
|
|
| CCDC142 c.1220G>A |
|
|
| CCDC168 c.17281G>A |
|
|
| CCDC22 c.442C>T |
|
|
| CCDC39 c.1189C>G |
|
|
| CCDC47 c.21C>A |
|
|
| CCDC70 c.239G>A |
|
|
| CCDC73 c.896C>T |
|
|
| CCDC8 c.316G>A |
|
|
| CCDC91 c.1163C>T |
|
|
| CCP110 c.2504G>T |
|
|
| CD3G c.497G>A |
|
|
| CD80 c.832G>A |
|
|
| CD9 c.85C>T |
|
|
| CDC25A c.1517G>A |
|
|
| CDH13 c.1498G>A |
|
|
| CDH23 c.691G>C |
|
|
| CDK18 c.1073G>A |
|
|
| CDKN2A c.23G>A |
|
|
| CDX4 c.455G>A |
|
|
| CEBPZ c.2155T>A |
|
|
| CELSR3 c.5802delC |
|
|
| CELSR3 c.9748C>T |
|
|
| CENPE c.2797G>A |
|
|
| CENPE c.4270C>T |
|
|
| CENPV c.596C>T |
|
|
| CEP170B c.1955T>C |
|
|
| CEP170B c.3520C>G |
|
|
| CEP250 c.589G>A |
|
|
| CFAP157 c.1441C>A |
|
|
| CFHR4 c.996C>A |
|
|
| CGB3 c.427G>T |
|
|
| CHADL c.868C>A |
|
|
| CHCHD10 c.227G>A |
|
|
| CHD2 c.2366G>A |
|
|
| CHD3 c.1796G>A |
|
|
| CHD3 c.3880G>A |
|
|
| CHPF c.2009A>T |
|
|
| CHRNA5 c.1192G>A |
|
|
| CHST13 c.716G>A |
|
|
| CIZ1 c.626G>A |
|
|
| CLCN6 c.698G>A |
|
|
| CLCNKA c.476G>A |
|
|
| CLDN15 c.301C>T |
|
|
| CLEC3A c.547G>T |
|
|
| CLEC4F c.839G>A |
|
|
| CLIP4 c.890G>C |
|
|
| CLSPN c.533G>A |
|
|
| CLTA c.698G>A |
|
|
| CLUH c.2743G>A |
|
|
| CMBL c.460G>A |
|
|
| CNR1 c.982C>T |
|
|
| CNTD2 c.164C>T |
|
|
| COL11A2 c.3100C>T |
|
|
| COL1A1 c.3680G>A |
|
|
| COL22A1 c.3584G>T |
|
|
| COL22A1 c.379C>T |
|
|
| COL27A1 c.2295C>A |
|
|
| COL4A1 c.3263G>A |
|
|
| COL6A2 c.1267C>T |
|
|
| COL6A5 c.5543G>A |
|
|
| CRB2 c.2873G>A |
|
|
| CREB3L1 c.1267C>T |
|
|
| CRH c.445G>A |
|
|
| CRYBG2 c.1418_1419insGTCCCCCACCTGGAAAGAGGTCGTGAAGGGCCCTGGTGCTCCTGCTGCCTC |
|
|
| CSMD1 c.1090G>A |
|
|
| CST9 c.289C>T |
|
|
| CT55 c.331A>T |
|
|
| CTAGE4 c.1963A>G |
|
|
| CTBP1 c.1130C>T |
|
|
| CTH c.589C>T |
|
|
| CTNNB1 c.1517T>A |
|
|
| CTTNBP2 c.3100G>A |
|
|
| CX3CL1 c.1130C>T |
|
|
| CXCR3 c.386G>A |
|
|
| CYBA c.437G>A |
|
|
| CYBB c.1461G>A |
|
|
| CYGB c.406G>A |
|
|
| CYP2F1 c.1028G>A |
|
|
| DAAM1 c.1015C>T |
|
|
| DAB2 c.2173C>A |
|
|
| DACH1 c.1726C>A |
|
|
| DALRD3 c.896A>G |
|
|
| DDIAS c.2524G>A |
|
|
| DEF8 c.1414G>A |
|
|
| DEFB121 c.154G>A |
|
|
| DENND1A c.1343G>T |
|
|
| DENND2C c.794G>A |
|
|
| DENND4A c.311G>A |
|
|
| DFFB c.379G>A |
|
|
| DGAT1 c.458G>A |
|
|
| DGKI c.40C>T |
|
|
| DHRSX c.721G>A |
|
|
| DNAH10 c.3640G>A |
|
|
| DNAH9 c.1243C>A |
|
|
| DNAH9 c.6584A>G |
|
|
| DOCK1 c.5259G>A |
|
|
| DOCK11 c.307G>A |
|
|
| DOCK2 c.543C>G |
|
|
| DOCK3 c.2086G>A |
|
|
| DOCK4 c.5740G>A |
|
|
| DOCK8 c.1205C>T |
|
|
| DRAM2 c.133G>T |
|
|
| EBPL c.20T>C |
|
|
| ECT2 c.619C>T |
|
|
| EFHC2 c.679G>C |
|
|
| EFHD1 c.88G>T |
|
|
| ELMSAN1 c.939dupC |
|
|
| ELOA2 c.1207G>T |
|
|
| ENC1 c.206G>A |
|
|
| ENDOG c.142G>A |
|
|
| ERFE c.467C>T |
|
|
| ESX1 c.959_985delCTGTGCCACCCGGGCCGCCCATGGCGC |
|
|
| EVC c.1168C>A |
|
|
| EVC2 c.2095A>G |
|
|
| EVI5 c.1213T>A |
|
|
| F8 c.3380G>A |
|
|
| FAAP100 c.22G>A |
|
|
| FAM135B c.2615G>T |
|
|
| FAM160B2 c.305delC |
|
|
| FAM161B c.932G>A |
|
|
| FAM192A c.634C>T |
|
|
| FAM210B c.245A>G |
|
|
| FAM212A c.216_218delGGA |
|
|
| FAM219A c.499G>A |
|
|
| FAM220A c.266C>T |
|
|
| FAM50B c.307C>T |
|
|
| FAM86B2 c.892+5A>G |
|
|
| FAM89A c.110C>T |
|
|
| FANCA c.4232C>T |
|
|
| FASN c.4447G>A |
|
|
| FASTKD3 c.20G>A |
|
|
| FBXO3 c.7G>A |
|
|
| FBXO33 c.101_109delAGCTGCGAC |
|
|
| FBXW10 c.1573G>A |
|
|
| FBXW12 c.174A>C |
|
|
| FBXW9 c.209G>A |
|
|
| FCF1 c.589C>T |
|
|
| FDX1L c.494C>T |
|
|
| FIGNL2 c.856G>A |
|
|
| FIP1L1 c.1180C>T |
|
|
| FKBP15 c.3637G>A |
|
|
| FLG c.5378G>A |
|
|
| FLII c.668G>A |
|
|
| FLNA c.6100C>T |
|
|
| FMR1 c.1544G>A |
|
|
| FOXD4 c.748_749delGGinsC |
|
|
| FOXN4 c.455delC |
|
|
| FOXO4 c.574C>T |
|
|
| FRAS1 c.5732A>G |
|
|
| FRS3 c.1336_1344delACCCACCCTinsCCCCCCCCC |
|
|
| FSCN2 c.853G>A |
|
|
| FSIP2 c.18617_18618delTA |
|
|
| FSTL1 c.755G>A |
|
|
| FUT7 c.49G>A |
|
|
| GAREM1 c.1673G>A |
|
|
| GATAD2B c.1704G>T |
|
|
| GGCT c.206C>A |
|
|
| GGT5 c.1334C>T |
|
|
| GGT7 c.1093G>A |
|
|
| GJA9 c.595G>A |
|
|
| GLI2 c.4672G>A |
|
|
| GLRA4 c.440C>T |
|
|
| GLT8D2 c.278G>A |
|
|
| GMPPB c.887G>A |
|
|
| GNB1 c.983C>A |
|
|
| GOLGA2 c.1483C>T |
|
|
| GOLGA8K c.1702G>A |
|
|
| GOLGA8K c.962A>C |
|
|
| GOLIM4 c.949C>T |
|
|
| GOLM1 c.179G>A |
|
|
| GP9 c.131C>T |
|
|
| GPC1 c.1030G>A |
|
|
| GPR149 c.1041C>A |
|
|
| GPR155 c.1384G>A |
|
|
| GPR50 c.514G>A |
|
|
| GPR52 c.18G>A |
|
|
| GPR6 c.715C>T |
|
|
| GPR83 c.321C>A |
|
|
| GPR88 c.568G>A |
|
|
| GRIA1 c.2318C>T |
|
|
| GRIA3 c.1913G>A |
|
|
| GRIA3 c.2431G>A |
|
|
| GRK7 c.1027G>A |
|
|
| GRK7 c.146G>A |
|
|
| GRN c.266C>A |
|
|
| GSE1 c.1201G>A |
|
|
| GSG2 c.611G>A |
|
|
| GTPBP1 c.1339C>T |
|
|
| GUCY2D c.2035G>A |
|
|
| GYG2 c.910C>T |
|
|
| HCFC1 c.4873G>A |
|
|
| HCN1 c.808C>T |
|
|
| HDDC2 c.385G>A |
|
|
| HDLBP c.1417C>T |
|
|
| HEPHL1 c.3193G>A |
|
|
| HES2 c.13C>A |
|
|
| HGSNAT c.1622C>T |
|
|
| HINT3 c.10G>A |
|
|
| HIP1 c.2956G>A |
|
|
| HIST1H2AL c.186G>C |
|
|
| HIST2H3D c.19A>C |
|
|
| HJURP c.520G>T |
|
|
| HMGA2 c.275C>T |
|
|
| HNRNPUL2 c.206G>A |
|
|
| HOXB9 c.232T>C |
|
|
| HOXD4 c.121G>A |
|
|
| HRG c.988G>A |
|
|
| HUNK c.1708C>T |
|
|
| HUWE1 c.11869C>A |
|
|
| HYAL3 c.428G>A |
|
|
| HYDIN c.10541G>A |
|
|
| ICAM3 c.869G>A |
|
|
| IFI30 c.34C>T |
|
|
| IFNA10 c.178C>T |
|
|
| IFT81 c.1313G>A |
|
|
| IGFN1 c.5179G>A |
|
|
| IGFN1 c.5683T>G |
|
|
| IGFN1 c.5695G>A |
|
|
| IGSF9B c.932G>A |
|
|
| IL12RB1 c.1097C>A |
|
|
| IL6ST c.1165G>A |
|
|
| ILF3 c.1480G>A |
|
|
| INA c.41_43delCCT |
|
|
| ING1 c.361C>T |
|
|
| INTS9 c.1412G>A |
|
|
| IQCH c.310C>T |
|
|
| IQGAP2 c.4025G>A |
|
|
| IQSEC3 c.1468G>A |
|
|
| ISM2 c.701C>T |
|
|
| ITGA1 c.3334G>A |
|
|
| ITGA9 c.1040C>T |
|
|
| ITGA9 c.433C>T |
|
|
| ITGAE c.1350_1352delGGC |
|
|
| ITIH5 c.2035C>T |
|
|
| ITLN2 c.176G>A |
|
|
| ITPK1 c.625G>A |
|
|
| JMJD7 c.889G>A |
|
|
| JPH3 c.1412C>T |
|
|
| JPH3 c.1688G>A |
|
|
| JSRP1 c.548C>T |
|
|
| KANK3 c.304G>A |
|
|
| KATNA1 c.443G>A |
|
|
| KCNAB3 c.689G>A |
|
|
| KCNE5 c.370C>T |
|
|
| KCNG1 c.1226C>T |
|
|
| KCNN4 c.264G>T |
|
|
| KCNQ4 c.2041G>A |
|
|
| KDM2A c.1939G>A |
|
|
| KDM6A c.3068G>A |
|
|
| KIAA0586 c.397C>T |
|
|
| KIAA1109 c.3686C>T |
|
|
| KIAA1324 c.1453G>A |
|
|
| KIF13A c.517C>T |
|
|
| KIF13B c.5231G>A |
|
|
| KIF17 c.1204G>A |
|
|
| KIF19 c.92C>T |
|
|
| KIF1B c.2119A>G |
|
|
| KIF1C c.2522C>T |
|
|
| KIF21B c.4303G>A |
|
|
| KIR2DS4 c.436A>T |
|
|
| KLK2 c.259G>A |
|
|
| KMT2A c.5755G>A |
|
|
| KMT2B c.265G>A |
|
|
| KNDC1 c.3065C>T |
|
|
| KRBA1 c.1058C>T |
|
|
| KRTAP17-1 c.125G>A |
|
|
| KRTAP17-1 c.140G>A |
|
|
| KSR1 c.254C>T |
|
|
| LAMA5 c.104C>T |
|
|
| LAMA5 c.7771C>G |
|
|
| LAMB2 c.2089C>T |
|
|
| LCE3D c.221G>A |
|
|
| LDOC1 c.417C>A |
|
|
| LEMD3 c.1873C>T |
|
|
| LINC00452 c.718G>A |
|
|
| LIPN c.748A>G |
|
|
| LKAAEAR1 c.182G>A |
|
|
| LMNA c.1634G>A |
|
|
| LMNA c.356G>A |
|
|
| LMTK3 c.1696G>A |
|
|
| LOC100506388 c.217C>T |
|
|
| LOC441155 c.35dupT |
|
|
| LOC729159 c.1004_1005delTGinsCA |
|
|
| LPAR2 c.733A>G |
|
|
| LRP1 c.4006G>A |
|
|
| LRRC32 c.1573C>T |
|
|
| LRRC56 c.899G>A |
|
|
| LRRC59 c.510G>C |
|
|
| LRRC8D c.914A>G |
|
|
| LRRN4 c.421A>G |
|
|
| LRRN4 c.442C>T |
|
|
| LYST c.7192G>A |
|
|
| LZTR1 c.1892G>A |
|
|
| MAD2L2 c.76G>T |
|
|
| MADD c.2251G>A |
|
|
| MAEL c.329T>C |
|
|
| MAGEA10 c.145C>T |
|
|
| MAGEA5 c.181C>T |
|
|
| MAGEL2 c.2626G>A |
|
|
| MAN2A1 c.1916dupA |
|
|
| MANEA c.1096C>T |
|
|
| MAP7D1 c.2182A>G |
|
|
| MARCH1 c.11G>T |
|
|
| MARCH2 c.275G>T |
|
|
| MAT1A c.280G>C |
|
|
| MCCC1 c.667G>A |
|
|
| MCM6 c.1693C>T |
|
|
| MED12L c.5813C>T |
|
|
| MED23 c.2836C>T |
|
|
| MIB2 c.208C>T |
|
|
| MIER2 c.1453A>G |
|
|
| MIGA2 c.508G>A |
|
|
| MIPEP c.1678C>T |
|
|
| MLIP c.1145C>A |
|
|
| MMAB c.733G>A |
|
|
| MMP16 c.391C>T |
|
|
| MMP24 c.119_121delTGC |
|
|
| MNT c.362C>T |
|
|
| MOV10L1 c.2459A>G |
|
|
| MRE11 c.1532delA |
|
|
| MRGPRE c.47G>A |
|
|
| MRGPRX4 c.69C>G |
|
|
| MROH8 c.598G>A |
|
|
| MST1R c.931delG |
|
|
| MTRNR2L3 c.2T>A |
|
|
| MUC12 c.9229C>A |
|
|
| MUC16 c.1031G>A |
|
|
| MUC19 c.18689G>C |
|
|
| MUC4 c.7666G>A |
|
|
| MUC4 c.8866G>A |
|
|
| MUT c.1532G>A |
|
|
| MYBPC2 c.3193G>A |
|
|
| MYH13 c.1440C>G |
|
|
| MYH9 c.4049_4051delAGG |
|
|
| MYLK3 c.1105C>A |
|
|
| MYO7A c.1091delC |
|
|
| NANOS1 c.517G>A |
|
|
| NBPF8 c.1714C>G |
|
|
| NCAPG2 c.2617C>T |
|
|
| NCS1 c.250G>A |
|
|
| NEO1 c.3193G>T |
|
|
| NFASC c.1747G>A |
|
|
| NISCH c.4270C>T |
|
|
| NKX2-5 c.211G>A |
|
|
| NLGN4X c.166C>T |
|
|
| NLRP3 c.226G>A |
|
|
| NOC2L c.994G>A |
|
|
| NOMO2 c.976G>A |
|
|
| NOTCH1 c.1892A>G |
|
|
| NPHS1 c.3250delG |
|
|
| NPTX2 c.979C>T |
|
|
| NTRK2 c.2272G>A |
|
|
| NUDT16 c.5C>T |
|
|
| NUDT7 c.259G>A |
|
|
| NUDT9 c.480delG |
|
|
| NUFIP1 c.1336G>A |
|
|
| NUFIP1 c.415A>T |
|
|
| NUP210 c.1159C>T |
|
|
| OBSCN c.11180G>A |
|
|
| OBSL1 c.4294C>T |
|
|
| OGDHL c.2591-11_2600delTGGTCCCTCAGGGACCAGCTT |
|
|
| ONECUT2 c.751C>T |
|
|
| OPRM1 c.266C>T |
|
|
| OR8G5 c.716G>A |
|
|
| OSBPL2 c.543delC |
|
|
| OVOL1 c.755C>T |
|
|
| PACS2 c.2428G>A |
|
|
| PADI2 c.95C>T |
|
|
| PALD1 c.1525G>T |
|
|
| PARD3 c.3457C>T |
|
|
| PARS2 c.599G>A |
|
|
| PCCB c.372G>A |
|
|
| PCDH9 c.3533C>T |
|
|
| PCDH9 c.923C>T |
|
|
| PCDHAC2 c.389C>T |
|
|
| PCDHB13 c.1966G>A |
|
|
| PCNX3 c.5516_5534delACTGTAGTGGGGGCGGTGG |
|
|
| PCSK4 c.328C>T |
|
|
| PCSK5 c.1543A>G |
|
|
| PDE12 c.806_807delTG |
|
|
| PDE1B c.1220C>T |
|
|
| PDE1C c.1733G>A |
|
|
| PDGFRA c.1365-4C>T |
|
|
| PDGFRA c.2645G>A |
|
|
| PDGFRB c.2183+1G>A |
|
|
| PDX1 c.172G>C |
|
|
| PDZRN3 c.2348C>T |
|
|
| PELP1 c.2285C>T |
|
|
| PGLYRP2 c.1711C>T |
|
|
| PHACTR1 c.1248G>A |
|
|
| PHACTR2 c.1429G>A |
|
|
| PHF8 c.1499G>A |
|
|
| PHF8 c.2385C>A |
|
|
| PHLDB1 c.3146G>A |
|
|
| PHLPP2 c.2843G>T |
|
|
| PHOX2B c.811C>G |
|
|
| PI4KA c.5701G>A |
|
|
| PID1 c.473C>G |
|
|
| PIDD1 c.992A>G |
|
|
| PIEZO1 c.3107G>A |
|
|
| PIGG c.1087C>T |
|
|
| PIGG c.2061G>A |
|
|
| PIN1 c.220C>T |
|
|
| PITPNC1 c.527G>T |
|
|
| PKHD1 c.5814G>T |
|
|
| PLCB1 c.2279G>A |
|
|
| PLEK2 c.458G>A |
|
|
| PLEKHA5 c.1070C>T |
|
|
| PLEKHG1 c.2273G>A |
|
|
| PLEKHM1 c.2174G>A |
|
|
| PLK5 c.505C>T |
|
|
| PLXNB1 c.4699G>A |
|
|
| PNPT1 c.1285-3_1288delAAGTTTCinsTTTTTTT |
|
|
| PODXL2 c.1217G>A |
|
|
| POLR2A c.1492G>A |
|
|
| POM121C c.1456A>T |
|
|
| POMT1 c.1648C>T |
|
|
| POTEF c.505C>A |
|
|
| POU3F3 c.259G>A |
|
|
| PPEF1 c.735C>A |
|
|
| PRAMEF11 c.1144A>C |
|
|
| PREP c.815G>A |
|
|
| PRR14L c.3470A>G |
|
|
| PRSS55 c.43G>A |
|
|
| PTPRS c.2192C>T |
|
|
| PTPRS c.2872C>A |
|
|
| QRICH2 c.3259G>A |
|
|
| QSOX2 c.994C>T |
|
|
| R3HCC1 c.309-1G>A |
|
|
| RAB21 c.41_43delCGG |
|
|
| RAD50 c.1684G>A |
|
|
| RAD54L2 c.1012A>G |
|
|
| RALGAPA2 c.1332G>T |
|
|
| RAPH1 c.1993G>A |
|
|
| RASAL3 c.2062G>A |
|
|
| RASAL3 c.2155G>C |
|
|
| RASGRF2 c.123G>C |
|
|
| RASGRP4 c.1501G>A |
|
|
| RB1 c.2359C>T |
|
|
| RBL1 c.294A>T |
|
|
| RBM25 c.1438G>A |
|
|
| RBM43 c.167C>T |
|
|
| RBMXL3 c.1307G>A |
|
|
| RBPMS c.50A>G |
|
|
| RFPL2 c.1018_1021delTTGCinsCTGT |
|
|
| RFPL2 c.970A>G |
|
|
| RGPD3 c.2468A>T |
|
|
| RGS20 c.1145C>T |
|
|
| RIMS4 c.597G>T |
|
|
| RIMS4 c.730G>C |
|
|
| RIOK3 c.1010C>T |
|
|
| RNASEL c.1419A>T |
|
|
| RNF114 c.680A>T |
|
|
| RNF123 c.3932C>T |
|
|
| RNF185 c.254G>A |
|
|
| RNF185 c.558G>A |
|
|
| RNF214 c.412G>A |
|
|
| RNH1 c.433G>T |
|
|
| RPAP3 c.1011delA |
|
|
| RPL18 c.335G>A |
|
|
| RPL4 c.427C>T |
|
|
| RPS6KA2 c.1756G>A |
|
|
| RPS6KB2 c.37G>A |
|
|
| RRBP1 c.2335G>A |
|
|
| RTN1 c.1600C>A |
|
|
| RTP5 c.281G>A |
|
|
| RUNDC1 c.337C>T |
|
|
| RXFP2 c.604C>T |
|
|
| SACS c.2488G>A |
|
|
| SALL3 c.1837G>A |
|
|
| SAMHD1 c.405_421delCATTGATACACCTCAAT |
|
|
| SAP30L c.193G>A |
|
|
| SAPCD1 c.119G>A |
|
|
| SBSN c.1583A>T |
|
|
| SCAP c.2892delC |
|
|
| SEC14L1 c.1129C>T |
|
|
| SEC14L4 c.287G>T |
|
|
| SEC24D c.907G>A |
|
|
| SH2D3C c.898C>T |
|
|
| SIGLEC9 c.17_19delTGC |
|
|
| SIRPG c.1141G>A |
|
|
| SLC22A8 c.583G>A |
|
|
| SLC26A4 c.575T>C |
|
|
| SLC2A5 c.964G>A |
|
|
| SLC2A6 c.961G>A |
|
|
| SLC2A8 c.576delC |
|
|
| SLC35F1 c.703G>A |
|
|
| SLC44A3 c.332A>T |
|
|
| SLC5A10 c.1211G>A |
|
|
| SLC6A13 c.1341C>A |
|
|
| SLC8A1 c.2011A>T |
|
|
| SLC8A3 c.2374G>A |
|
|
| SLIT3 c.182G>A |
|
|
| SMARCA4 c.4185delA |
|
|
| SMARCAD1 c.1637G>A |
|
|
| SOBP c.1950G>T |
|
|
| SOGA1 c.1477G>T |
|
|
| SOST c.278C>A |
|
|
| SOX18 c.698C>T |
|
|
| SP140 c.2167G>A |
|
|
| SP8 c.326G>A |
|
|
| SPATA31A6 c.1997A>G |
|
|
| SPATA31E1 c.2987G>A |
|
|
| SPINK2 c.118A>G |
|
|
| SPIRE2 c.470_472delAGG |
|
|
| SPOCD1 c.3199G>A |
|
|
| SREBF2 c.85G>A |
|
|
| SSC4D c.1154C>T |
|
|
| SSH2 c.2626G>C |
|
|
| SSPO c.13487A>G |
|
|
| SSPO c.1967G>T |
|
|
| SSTR1 c.121C>T |
|
|
| STAC3 c.226_227insGGG |
|
|
| STK26 c.1073C>T |
|
|
| STK33 c.1280G>C |
|
|
| STK38L c.148G>A |
|
|
| STK40 c.1198G>A |
|
|
| STT3B c.957T>G |
|
|
| SUDS3 c.397_399delAAG |
|
|
| SUSD3 c.428C>T |
|
|
| SYCP2 c.4180C>T |
|
|
| SYN2 c.544G>A |
|
|
| SYNE2 c.9263G>A |
|
|
| TACC2 c.2488C>T |
|
|
| TACC2 c.3196G>A |
|
|
| TACC3 c.1847C>T |
|
|
| TAF1D c.281delA |
|
|
| TBL1X c.826C>T |
|
|
| TEKT4 c.824G>A |
|
|
| TET1 c.5408G>A |
|
|
| TEX264 c.875G>A |
|
|
| TFAP2E c.305C>T |
|
|
| TFRC c.1763G>A |
|
|
| TGM4 c.937G>A |
|
|
| THEMIS2 c.1527_1531delTGTGAinsCGTGG |
|
|
| TIGD4 c.373G>A |
|
|
| TLN1 c.7088C>T |
|
|
| TMC6 c.2054G>A |
|
|
| TMCO6 c.464T>A |
|
|
| TMEM151A c.3G>A |
|
|
| TMEM165 c.703C>G |
|
|
| TMEM200B c.338G>T |
|
|
| TMEM232 c.1045G>A |
|
|
| TMEM237 c.1159G>A |
|
|
| TMEM59L c.800G>A |
|
|
| TMEM63C c.2128C>T |
|
|
| TMEM70 c.113G>T |
|
|
| TMEM94 c.859G>A |
|
|
| TNFSF18 c.355A>G |
|
|
| TNRC18 c.3076A>C |
|
|
| TNRC6B c.4934G>A |
|
|
| TOGARAM1 c.2390A>C |
|
|
| TOP2B c.1057C>G |
|
|
| TOP2B c.247G>A |
|
|
| TPR c.583A>G |
|
|
| TRDN c.1900G>A |
|
|
| TRIM61 c.365C>G |
|
|
| TRIM64B c.377delG |
|
|
| TRPV1 c.1753A>G |
|
|
| TSEN2 c.247C>G |
|
|
| TSEN2 c.451G>A |
|
|
| TSEN2 c.506G>A |
|
|
| TTK c.1324_1327delTCTA |
|
|
| TTN c.68658G>C |
|
|
| TTN c.68716C>A |
|
|
| TTPA c.103G>A |
|
|
| TULP4 c.4571C>T |
|
|
| TXNRD2 c.1522C>T |
|
|
| UBASH3B c.32G>A |
|
|
| UBE4A c.2306G>A |
|
|
| USP32 c.2804G>A |
|
|
| USPL1 c.3256G>A |
|
|
| VGLL2 c.794C>T |
|
|
| WDFY3 c.1262T>C |
|
|
| WDR18 c.1075C>A |
|
|
| XKR4 c.1918A>T |
|
|
| XPO4 c.238C>T |
|
|
| XPO7 c.2398C>T |
|
|
| ZAR1 c.1145C>T |
|
|
| ZC3H12B c.2285G>A |
|
|
| ZC3H12D c.1213C>T |
|
|
| ZC3H7B c.1569C>G |
|
|
| ZC3H8 c.220G>A |
|
|
| ZDBF2 c.5228C>T |
|
|
| ZMPSTE24 c.1085dupT |
|
|
| ZMYM1 c.1965G>A |
|
|
| ZMYM5 c.74C>T |
|
|
| ZMYND15 c.1468G>A |
|
|
| ZNF10 c.1658C>T |
|
|
| ZNF207 c.673A>G |
|
|
| ZNF208 c.766T>C |
|
|
| ZNF276 c.548C>T |
|
|
| ZNF365 c.307G>A |
|
|
| ZNF367 c.854G>A |
|
|
| ZNF37A c.1369C>T |
|
|
| ZNF383 c.820C>T |
|
|
| ZNF420 c.34G>T |
|
|
| ZNF431 c.1260G>A |
|
|
| ZNF431 c.1462G>A |
|
|
| ZNF431 c.1525G>C |
|
|
| ZNF474 c.757C>T |
|
|
| ZNF493 c.802G>A |
|
|
| ZNF536 c.3551A>C |
|
|
| ZNF568 c.1066C>A |
|
|
| ZNF680 c.1016A>G |
|
|
| ZNF696 c.430C>T |
|
|
| ZNF782 c.1630G>A |
|
|
| ZNFX1 c.1982C>T |
|
|
| ZP1 c.1103G>A |
|
|
| ZYX c.697C>T |
|
|
| ABCA5 c.725_727delCAGinsAAA |
|
|
| ACSF3 c.1180C>A |
|
|
| ADAMTS2 c.2243C>T |
|
|
| ADCK2 c.253C>T |
|
|
| ADGRA1 c.227G>A |
|
|
| ADGRF3 c.1615G>A |
|
|
| ADGRG2 c.1314C>A |
|
|
| ADGRV1 c.16006C>A |
|
|
| AFAP1 c.140A>G |
|
|
| AHNAK c.14273A>G |
|
|
| AHRR c.1881C>A |
|
|
| AKAP13 c.5222C>A |
|
|
| AKR1B15 c.452delT |
|
|
| ALS2CR12 c.1079C>A |
|
|
| ALX3 c.226G>A |
|
|
| AMOTL2 c.2426G>A |
|
|
| ANK3 c.9349dupA |
|
|
| ANKRD33 c.112G>A |
|
|
| ANXA10 c.655G>T |
|
|
| AP4B1 c.1657G>A |
|
|
| APPBP2 c.863C>A |
|
|
| ARHGAP6 c.1393G>C |
|
|
| ARID1A c.492_494delCGC |
|
|
| ARMC12 c.829G>A |
|
|
| ARSE c.1750C>A |
|
|
| ATM c.458G>T |
|
|
| ATM c.6889C>G |
|
|
| ATP10D c.545G>T |
|
|
| ATXN3 c.911_912insACAGCAGCAGCAGCAGCAGCAGCA |
|
|
| ATXN7 c.59_61delCGG |
|
|
| BCR c.3055G>A |
|
|
| BRIX1 c.494T>C |
|
|
| BTG2 c.17G>A |
|
|
| C10orf76 c.1715T>C |
|
|
| C10orf82 c.343G>T |
|
|
| C10orf95 c.581G>A |
|
|
| C12orf56 c.989A>G |
|
|
| C16orf86 c.922C>T |
|
|
| C3 c.641C>A |
|
|
| CACFD1 c.665_668delCCCT |
|
|
| CAMKK2 c.1599_1601delGACinsAACAAAA |
|
|
| CAPN13 c.1888A>G |
|
|
| CASKIN2 c.3538A>G |
|
|
| CASQ2 c.51C>A |
|
|
| CCDC106 c.138G>T |
|
|
| CCDC114 c.601A>G |
|
|
| CCDC144A c.1001C>A |
|
|
| CCDC168 c.15025G>A |
|
|
| CCDC25 c.137C>A |
|
|
| CCDC93 c.1321G>T |
|
|
| CCNI2 c.460G>A |
|
|
| CCNL2 c.532A>G |
|
|
| CCT3 c.591delA |
|
|
| CD1B c.418G>T |
|
|
| CD7 c.44C>G |
|
|
| CDH17 c.1315G>A |
|
|
| CDK6 c.631G>A |
|
|
| CECR2 c.3651_3655dupAACCC |
|
|
| CELSR1 c.5418G>T |
|
|
| CEP128 c.3073G>T |
|
|
| CEP290 c.5517G>T |
|
|
| CEP85L c.11G>T |
|
|
| CFAP36 c.685G>A |
|
|
| CFAP53 c.984_988delGAAACinsAAAAA |
|
|
| CFAP65 c.2247G>A |
|
|
| CFAP97 c.481delA |
|
|
| CGB3 c.16-2A>T |
|
|
| CHEK2 c.1409A>G |
|
|
| CIZ1 c.346C>A |
|
|
| CLCN1 c.2435_2445delAGCCTGTCTGT |
|
|
| CLCN3 c.1469G>A |
|
|
| CLDN19 c.503G>A |
|
|
| CLEC18C c.299T>C |
|
|
| CLN5 c.272C>T |
|
|
| CLPTM1L c.1295T>A |
|
|
| CNOT1 c.4630_4635delCTGTTAinsTTTTTT |
|
|
| CNTN6 c.2759G>A |
|
|
| COL11A2 c.2102C>T |
|
|
| COL19A1 c.1703G>A |
|
|
| COL27A1 c.1908G>A |
|
|
| CP c.2291C>T |
|
|
| CPB2 c.340delC |
|
|
| CRYBG3 c.4646C>A |
|
|
| CXCL6 c.86C>T |
|
|
| CXorf36 c.587G>A |
|
|
| CYP11B2 c.1471C>A |
|
|
| DCC c.601C>T |
|
|
| DEPDC1B c.682G>A |
|
|
| DHRS2 c.287A>T |
|
|
| DHX29 c.3296C>A |
|
|
| DLG5 c.2296G>T |
|
|
| DNAAF3 c.976G>A |
|
|
| DNAH9 c.6762G>T |
|
|
| DOLPP1 c.500A>T |
|
|
| DSC2 c.934G>T |
|
|
| DST c.4384G>T |
|
|
| EML5 c.824G>A |
|
|
| ENAM c.869G>A |
|
|
| ENO4 c.1751A>T |
|
|
| ENPEP c.1552G>T |
|
|
| EOGT c.419C>T |
|
|
| EPG5 c.6263T>G |
|
|
| EREG c.143G>A |
|
|
| ESRP2 c.381G>A |
|
|
| EXOSC10 c.1751C>T |
|
|
| F13A1 c.1909-883_2038dup |
|
|
| F2RL1 c.280G>A |
|
|
| FAM186A c.4757_4828delAACTGGGGATCCCTCTCACCCCTCAGC AGGCGCAGGAACTGGGGATCCCTCTCACCCCTCAGCAGGC GCAGG |
|
|
| FAM193A c.1769C>T |
|
|
| FAM90A1 c.1261G>T |
|
|
| FAM9B c.285G>T |
|
|
| FANCI c.153C>A |
|
|
| FARSB c.1177C>T |
|
|
| FAT1 c.10630G>A |
|
|
| FBL c.407C>T |
|
|
| FGF10 c.365C>T |
|
|
| FIG4 c.2347G>A |
|
|
| FIG4 c.2586A>T |
|
|
| FNTA c.408C>A |
|
|
| FOXRED1 c.104C>T |
|
|
| FOXRED1 c.65G>A |
|
|
| FXR2 c.994A>G |
|
|
| GAB3 c.1307C>A |
|
|
| GAGE2A c.175C>G |
|
|
| GALR2 c.646C>A |
|
|
| GDF7 c.955C>T |
|
|
| GFRA1 c.665C>T |
|
|
| GGT1 c.1081G>C |
|
|
| GHR c.1705C>A |
|
|
| GIPR c.301C>T |
|
|
| GKAP1 c.424G>A |
|
|
| GKAP1 c.427G>A |
|
|
| GKAP1 c.432C>A |
|
|
| GLP1R c.16G>T |
|
|
| GLYATL2 c.680A>C |
|
|
| GLYATL2 c.705A>C |
|
|
| GLYR1 c.1120G>A |
|
|
| GMNN c.161G>A |
|
|
| GNRH2 c.40_42delCTG |
|
|
| GOLGA8A c.1463C>T |
|
|
| GOLGA8A c.1505G>A |
|
|
| GOLGA8A c.1538G>A |
|
|
| GRIK4 c.2590C>T |
|
|
| GRM7 c.2014G>A |
|
|
| H2AFY c.10C>T |
|
|
| HAUS5 c.425C>T |
|
|
| HERC1 c.11036G>A |
|
|
| HIF3A c.1573C>T |
|
|
| HOXA13 c.396_398delCGC |
|
|
| HOXD13 c.120C>A |
|
|
| HRH1 c.1048C>A |
|
|
| HRNR c.7688G>C |
|
|
| HSD17B12 c.682C>T |
|
|
| HSPG2 c.8873C>T |
|
|
| HUWE1 c.1553C>A |
|
|
| HUWE1 c.1924G>T |
|
|
| HUWE1 c.7633C>A |
|
|
| ICAM4 c.38dupT |
|
|
| IGFN1 c.5612A>G |
|
|
| IGFN1 c.5624C>G |
|
|
| IL12RB1 c.1442G>A |
|
|
| ILF2 c.40_41delGGinsTT |
|
|
| IQSEC3 c.973G>A |
|
|
| ITGAD c.2240G>A |
|
|
| ITPR2 c.8022G>T |
|
|
| JKAMP c.158G>C |
|
|
| JPH3 c.169A>G |
|
|
| KIAA0513 c.646G>T |
|
|
| KIAA0895 c.720C>G |
|
|
| KIAA1107 c.3152C>A |
|
|
| KIAA1107 c.3310C>A |
|
|
| KIF5C c.226G>T |
|
|
| KLHL34 c.1513G>T |
|
|
| KLHL9 c.825T>G |
|
|
| KLRK1 c.197G>A |
|
|
| KMT5C c.1141dupC |
|
|
| KNL1 c.1800G>T |
|
|
| KRT13 c.610G>A |
|
|
| KRTAP9-9 c.35_36insACCTGCTGCAGGACC |
|
|
| LCA5L c.1198G>A |
|
|
| LCAT c.625C>A |
|
|
| LCT c.1925C>A |
|
|
| LDB3 c.2012G>A |
|
|
| LILRB5 c.1274C>T |
|
|
| LMNA c.1977G>T |
|
|
| LMO7 c.1315T>C |
|
|
| LOC100505841 c.50G>A |
|
|
| LOC101928841 c.3272G>A |
|
|
| LONRF3 c.712C>A |
|
|
| LRP2 c.13139dupC |
|
|
| LRRC4 c.912_913delTG |
|
|
| LRRC40 c.1457C>T |
|
|
| LRRK1 c.644G>A |
|
|
| LTBP1 c.307C>T |
|
|
| MADD c.3458C>T |
|
|
| MAP2K2 c.1069C>T |
|
|
| MAZ c.272C>T |
|
|
| MED21 c.35T>G |
|
|
| MED23 c.2276dupA |
|
|
| METTL5 c.388G>A |
|
|
| MICALL1 c.2475C>A |
|
|
| MIER3 c.1113delG |
|
|
| MMP2 c.1484G>A |
|
|
| MMP24 c.170_172delCGG |
|
|
| MRPL21 c.581G>A |
|
|
| MRVI1 c.1446delA |
|
|
| MUC12 c.13432C>A |
|
|
| MUC12 c.2740T>C |
|
|
| MUC12 c.4291G>A |
|
|
| MUC12 c.5251A>C |
|
|
| MUC12 c.5512C>A |
|
|
| MUC12 c.5575G>A |
|
|
| MUC12 c.5612C>T |
|
|
| MUC16 c.17447G>A |
|
|
| MUC19 c.3641G>A |
|
|
| MUC4 c.3605T>C |
|
|
| MUC4 c.7039A>T |
|
|
| MUC4 c.8259_10034dup |
|
|
| MVD c.665G>A |
|
|
| MX1 c.454G>A |
|
|
| MYCBP2 c.1826C>T |
|
|
| MYCBP2 c.3572C>T |
|
|
| MYH14 c.2935G>A |
|
|
| MYOF c.1772_1773delAG |
|
|
| MYOM3 c.221C>T |
|
|
| NALCN c.2063_2065delCCT |
|
|
| NANOGNB c.495_501delGCATAAGinsAAAAAAA |
|
|
| NBEA c.5218G>T |
|
|
| NCKIPSD c.1430C>T |
|
|
| NEB c.17635-2_17635delAGAinsTTT |
|
|
| NEK1 c.739C>T |
|
|
| NEPRO c.837delA |
|
|
| NEUROD6 c.89A>G |
|
|
| NFATC1 c.179C>T |
|
|
| NHS c.2203C>T |
|
|
| NLRP12 c.2971C>A |
|
|
| NLRP14 c.3228G>T |
|
|
| NLRP6 c.176C>T |
|
|
| NMD3 c.754G>T |
|
|
| NPHP3 c.1525-4_1526delCTAGTAinsTTTTTT |
|
|
| NR2E1 c.592C>A |
|
|
| NRAP c.4058G>T |
|
|
| NRG2 c.2084G>A |
|
|
| NUCB1 c.664C>T |
|
|
| NUP98 c.2972C>A |
|
|
| NYAP2 c.703G>A |
|
|
| NYNRIN c.3662G>A |
|
|
| OBSCN c.6543G>C |
|
|
| OR13C5 c.243_244delGC |
|
|
| OR2T2 c.612_618delCGTGCTG |
|
|
| OR2T2 c.785T>A |
|
|
| OR2T3 c.611T>C |
|
|
| OR2T8 c.590T>G |
|
|
| OR2W3 c.337C>A |
|
|
| OR4C12 c.222_224delTTC |
|
|
| OR51A4 c.497_500delGAAAinsCAAG |
|
|
| OR52D1 c.127G>T |
|
|
| OSMR c.937G>T |
|
|
| OTOF c.5567G>A |
|
|
| PADI3 c.1739C>A |
|
|
| PCDH18 c.809C>T |
|
|
| PCDH8 c.1583G>A |
|
|
| PCLO c.2545G>A |
|
|
| PGLYRP3 c.551G>T |
|
|
| PGS1 c.1069A>G |
|
|
| PIGO c.3116delT |
|
|
| PKD1 c.2647C>A |
|
|
| PLD3 c.464C>T |
|
|
| PLK2 c.328G>A |
|
|
| PLXNA1 c.1114C>T |
|
|
| PLXND1 c.1393G>A |
|
|
| PML c.1753delC |
|
|
| PODXL2 c.1230delG |
|
|
| POLQ c.6811C>A |
|
|
| POLR2B c.632delA |
|
|
| POM121 c.1916A>C |
|
|
| POM121C c.1162_1169delTTTGACTCinsCT |
|
|
| POTEB2 c.119C>A |
|
|
| PPP1R12C c.1907C>G |
|
|
| PPP2R2B c.1196G>A |
|
|
| PPWD1 c.197-6_198delCTTCAGTCinsTTTTTTTT |
|
|
| PRAMEF2 c.280C>T |
|
|
| PRKDC c.2601C>A |
|
|
| PROSER1 c.1587G>T |
|
|
| PRR19 c.355C>T |
|
|
| PRRT3 c.543G>T |
|
|
| PRSS56 c.1646G>A |
|
|
| PTPN13 c.4093G>T |
|
|
| R3HDM2 c.79_80delAA |
|
|
| RABGEF1 c.854C>T |
|
|
| RAD50 c.2165delA |
|
|
| RAP2B c.56T>G |
|
|
| RASGEF1A c.1062delC |
|
|
| RBM15 c.1231G>A |
|
|
| RBMX c.217-2_217-1delAGinsTT |
|
|
| RD3 c.292C>T |
|
|
| RGPD1 c.4329A>C |
|
|
| RGS17 c.55C>T |
|
|
| RIMBP2 c.2627C>T |
|
|
| RLBP1 c.307C>T |
|
|
| RNF128 c.103G>A |
|
|
| RRN3 c.337A>G |
|
|
| RSL1D1 c.1147-5_1147delCTTAGAinsTTTTTT |
|
|
| RSPH3 c.1186G>A |
|
|
| RTTN c.5365G>A |
|
|
| S100A7 c.139T>G |
|
|
| SAMD13 c.169G>A |
|
|
| SCML2 c.654G>T |
|
|
| SCN1A c.1363C>A |
|
|
| SCN7A c.2098G>A |
|
|
| SCRIB c.4063C>T |
|
|
| SDK1 c.1769C>A |
|
|
| SDK2 c.4706C>A |
|
|
| SEC24A c.2346C>A |
|
|
| SEMA6D c.509C>T |
|
|
| SESN1 c.1469G>A |
|
|
| SFT2D3 c.314C>T |
|
|
| SHANK1 c.1329G>T |
|
|
| SHANK1 c.1366G>A |
|
|
| SHROOM2 c.2815C>A |
|
|
| SIX3 c.406_407delGC |
|
|
| SLC30A10 c.1408C>A |
|
|
| SPTBN5 c.2405G>A |
|
|
| SPTLC1 c.1110C>A |
|
|
| ST7 c.1658G>C |
|
|
| STARD9 c.1654C>T |
|
|
| STK32A c.326G>A |
|
|
| STRBP c.709C>T |
|
|
| SVIL c.2083G>A |
|
|
| SYNE1 c.23551A>G |
|
|
| SYNGR1 c.34G>A |
|
|
| TACC2 c.798G>T |
|
|
| TCF7L1 c.40_42delGGC |
|
|
| TCTN2 c.127G>A |
|
|
| TEX30 c.132_133delTC |
|
|
| TFCP2L1 c.161C>T |
|
|
| TM4SF1 c.199T>G |
|
|
| TMEM202 c.603C>G |
|
|
| TMEM26 c.709G>T |
|
|
| TMEM72 c.490G>A |
|
|
| TMOD3 c.151C>G |
|
|
| TMPO c.514A>G |
|
|
| TMPRSS6 c.435C>A |
|
|
| SKP1 c.21G>T |
|
|
| SLC25A12 c.887C>A |
|
|
| SLC2A11 c.995C>T |
|
|
| SLC35F2 c.448G>A |
|
|
| SLC38A2 c.549T>G |
|
|
| SLC39A6 c.1088C>T |
|
|
| SLC5A2 c.236G>A |
|
|
| SLC7A14 c.1963T>C |
|
|
| SLC7A9 c.887G>A |
|
|
| SLU7 c.576delA |
|
|
| SOAT1 c.1421T>G |
|
|
| SOCS6 c.781G>A |
|
|
| SORBS1 c.3400G>A |
|
|
| SP140 c.205G>T |
|
|
| SPATA31E1 c.2651G>A |
|
|
| SPPL2B c.634G>T |
|
|
| TMPRSS6 c.943G>A |
|
|
| TNFAIP2 c.512_514delCGG |
|
|
| TNXB c.8806G>A |
|
|
| TOGARAM2 c.2090C>A |
|
|
| TOP3B c.2299T>C |
|
|
| TRIM17 c.232C>T |
|
|
| TRIM28 c.335G>A |
|
|
| TRIM3 c.2235G>T |
|
|
| TRIO c.9289G>C |
|
|
| TRIP12 c.1099C>T |
|
|
| TSHZ1 c.1204G>A |
|
|
| TSPEAR c.59C>T |
|
|
| TSSC4 c.538G>T |
|
|
| TVP23A c.271T>C |
|
|
| UBD c.3G>A |
|
|
| UBE2O c.1813G>A |
|
|
| UGDH c.1294delA |
|
|
| UGGT2 c.3474-467_3480del |
|
|
| URI1 c.49G>T |
|
|
| USP28 c.2845C>T |
|
|
| USP34 c.1142C>A |
|
|
| UTF1 c.302C>T |
|
|
| VSTM2B c.457G>A |
|
|
| VSTM2B c.603C>A |
|
|
| WASHC2C c.1562A>C |
|
|
| WASHC2C c.691G>T |
|
|
| WDR33 c.160C>T |
|
|
| WFS1 c.577_579delAAG |
|
|
| WISP1 c.580A>G |
|
|
| WWC1 c.2972T>G |
|
|
| YBX3 c.40_42delACC |
|
|
| ZFPM1 c.2596C>T |
|
|
| ZNF148 c.2380_2383delGGCTinsAA |
|
|
| ZNF185 c.1222G>A |
|
|
| ZNF221 c.335C>T |
|
|
| ZNF354C c.1060A>G |
|
|
| ZNF366 c.1475T>G |
|
|
| ZNF41 c.1700_1702delAAA |
|
|
| ZNF521 c.3122T>C |
|
|
| ZNF550 c.157C>A |
|
|
| ZNF552 c.524_525dupGG |
|
|
| ZNF552 c.533T>G |
|
|
| ZNF628 c.794C>A |
|
|
| ZNF883 c.664C>A |
|
|
| ZSWIM6 c.82_84dupAGC |
|
|
| OG003 | Cohort 4: HR+ HER2- Adenocarcinoma of the Breast | Progressive disease on 1st line combination of doublet palbociclib with hormonal therapy. |
| OG004 | Cohort 5: Castrate-resistant Adenocarcinoma of the Prostate | Progressive disease on enzalutamide monotherapy. |
| OG005 | Cohort 6: Castrate-resistant Adenocarcinoma of the Prostate | Progressive disease on abiraterone in combination with prednisone. |
| OG006 | Cohort 7: gBRCAm HER2- Adenocarcinoma of the Breast | Progressive disease on a PARP inhibitor monotherapy in participants previously treated with chemotherapy in the neoadjuvant, adjuvant, or metastatic setting. |
|
|
| Units |
|---|
| Counts |
|---|
| Participants |
|
|
|
|
|
|
|
|
Progressive disease on enzalutamide monotherapy and on abiraterone in combination with prednisone.
|
|